DBT BET 2019 QUESTIONS AND ANSWER KEY
PART A
1. The major difference between hormones that have intracellular receptors and those that have cell membrane receptors is that the former is usually:
a. Charged
b. Hydrophilic
c. Glycosylated
d. Hydrophobic
Ans. d
2. A patient suffering from allergy has been advised to take anti-histamine drugs. Which one of the following biological processes is most likely to be the reason for the allergy?
a. Mast cell degranulation
b. Thymocyte maturation
c. Somatic hypermutation
d. Bystander lysis
Ans. a
3. Which one of the following statements is NOT TRUE for an enhancer element?
a. it can be downstream of the gene it regulates
b. it can only regulate a nearby gene
c. it can be upstream of the gene it regulates
d. it can be within the intron of the gene
Ans. b
4. Which one of the following statements about alleles is NOT TRUE?
a. They may occupy different loci in the same chromosome
b. There may be several at one locus
c. One may be dominant over another
d. They may show co-dominance
Ans. a
5. Allele ‘A’ is dominant over allele ‘a’ and results in dark skin pigmentation. In a mating of Aa with Aa, if 6 offspring are produced, the probability of all having dark pigment is:
a. 0.18
b. 0.75
c. 0.24
d. 0.12
Ans. a
6. A bacterial culture grown in a medium containing radioactive sulphur would incorporate the radiolabel in the tetra-peptide:
a. serine-cysteine-tyrosine-methionine.
b. threonine-lysine-aspartic acid-glutamic acid.
c. alanine-proline-histidine-glycine.
d. tryptophan-phenylalanine-valine-isoleucine
Ans. a
7. Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is:
a. ATGACATTATTACATTAGTG
b. GCGCGTGCATGCCCGATGCC
c. ATTATTATACGTATTTATAT
d. CGCGATCGGGGATTACGAGC
Ans. b
8. A peptide of sequence -SHELR- is isolated from bacteria. Which one of the following options lists the possible phosphorylation site in this peptide?
a. H
b. L
c. R
d. E
Ans. a
9. Competitive inhibition of an enzyme can be reduced by:
a. Reducing the amount of the substrate
b. Increasing the amount of the substrate
c. Decreasing the amount of the enzyme
d. Diluting the reaction mixture
Ans. b
10. The sequence of first strand of DNA obtained after reverse transcription of a bacterial mRNA is the same as:
a. Anti-sense DNA strand
b. Sense DNA strand
c. mRNA
d. Anti-sense RNA
Ans. a
11. Statins inhibit biosynthesis of:
a. Prostaglandins
b. Leukotrienes
c. Serotonin
d. Cholesterol
Ans. d
12. A fetus with which one of the following karyotypes will NOT survive at birth?
a. 45, Y
b. 47, XY+13
c. 45, X
d. 47, XY+21
Ans. a
13. If a cell carries 21 pairs of chromosomes just after completion of mitotic telophase, how many chromatids will be there in metaphase?
a. 21
b. 42
c. 84
d. 168
Ans. c
14. Molecular mass of a protein CANNOT be determined by:
a. MALDI-TOF
b. Gel filtration Chromatography
c. Chromatofocusing
d. SDS-PAGE
Ans. c
15. Lack of reactivity to self HLA is known as?
a. Autoimmunity
b. Complement fixation
c. Clonal selection
d. Tolerance
Ans. d
16. The frequency of two alleles in a population is 0.19 (B) and 0.81(b). If the population is in Hardy-Weinberg equilibrium, what will be the percentage of heterozygous individuals in the population?
a. 62%
b. 38%
c. 31%
d. 19%
Ans. c
17. Which one of the following intermediate filament proteins is present in the nucleus?
a. Vinculin
b. Lamin
c. Nestin
d. Laminin
Ans. b
18. All the DNA strands of a cell containing 4 chromosomes are labelled. After one division how many chromosomes in the daughter cell will have labelled DNA?
a. 1
b. 2
c. 4
d. 8
Ans. c
19. Which one of the following statements is INCORRECT about facilitated diffusion?
a. Its rate is higher than simple diffusion.
b. The partition coefficient of the solute is irrelevant for it.
c. It can be saturated at high concentration of the solute.
d. It works against the concentration gradient.
Ans. d
20. Variable number of tandem repeats (VNTR) in DNA molecule are highly useful in:
a. Fingerprinting
b. Footprinting
c. Gene annotation
d. DNA repair
Ans. a
21. Bovine spongiform encephalopathy is a disease caused by:
a. Fungus
b. Bacteria
c. Prions
d. Viroids
Ans. c
22. Which one of the following is used to study the structural details of biological tissues using freeze-fracture technique?
a. Scanning electron microscopy
b. Transmission electron microscopy
c. Atomic force microscopy
d. Phase contrast microscopy
Ans. b
23. Which one of the following assures prevention of polyspermy in an egg?
a. Activation of PI3 kinase
b. Cortical reaction
c. Acrosome reaction
d. Cross-linking between ZP1 and ZP3
Ans. b
24. Cytotoxic T cells generally recognize antigen in association with:
a. class II MHC determinants
b. class I MHC determinants
c. class III MHC determinants
d. HLA-DR determinants
Ans. b
25. With reference to protein precipitation by organic solvents, which one of the following statements is correct?
a. It is not influenced by pH.
b. It is dependent on the change in dielectric constant.
c. It is unaffected by ionic strength.
d. It is independent of the molecular size of the protein.
Ans. a
26. An organism exhibits Monod growth with the following growth parameters, µm= 0.6h-1 & Ks = 4 g/l. The specific growth rate, µ, of the organism at a substrate concentration of 2 g/l would be:
a. 0.2 h-1
b. 0.3 h-1
c. 0.4 h-1
d. 1.2 h-1
Ans. a
27. What is 10! / 8!
a. 2!
b. 1.25!
c. 90
d. 1.25
Ans. c
28. A cricketer has an average of 62 runs after playing 25 innings. How many runs should he score in the next innings so as to increase his average to 65 runs?
a. 147
b. 122
c. 140
d. 180
Ans. c
29. The next number in the series 1, 1, 2, 3, 5, 8, 13, 21 is:
a. 27
b. 29
c. 32
d. 34
Ans. d
30. A TE buffer contains 200 mM Tris and 50 mM EDTA. Given the stock solutions – 0.5M Tris and 0.5 M EDTA, volumes of stock solutions required to make 1 liter of buffer solution are respectively:
a. 400 ml, 100 ml
b. 200 ml, 50 ml
c. 500 ml, 125 ml
d. 100 ml, 25 ml
Ans. a
31. The pH of a 0.001 molar HCl solution in H2O is:
a. 1
b. 2
c. 3
d. 4
Ans. c
32. To make 2 liters of 0.4 M HCl, how many ml of 28% w/w HCl (specific gravity = 1.15) is required?
a. 80.7
b. 90.7
c. 100.7
d. 110.7
Ans. b
33. Two sides of a triangle measure 4 cm and 7 cm. Which one of the following CANNOT be a measure of the third side?
a. 4 cm
b. 5 cm
c. 8 cm
d. 11 cm
Ans. d
34. A boy appears for a test and scores 35% but fails by 10 marks. If he had scored 46%,nhe would have passed by 12 marks. What is the pass mark?
a. 70
b. 74
c. 80
d. 86
Ans. c
35. If a student runs at 1.5 times his usual speed, he reaches his school 20 minutes early. If he runs at 0.5 times his usual speed, how late will he reach his school?
a. 60 min
b. 30 min
c. 45 min
d. 15 min
Ans. a
36. A stationary car is accelerated at the rate of 5 m/s2. The distance covered by the car till it reaches a speed of 40 m/s is:
a. 100 m
b. 120 m
c. 160 m
d. 200 m
Ans. c
37. Find the missing number in the following series:
a. 27
b. 25
c. 29
d. 32
Ans. a
38. Identify the next figure in the series
Ans. a
39. If the total number of dots on opposite faces of a cubical block is always 9 and no number is repeated, which of the following figure represents the block:
a. (i)
b. (iii)
c. (ii)
d. (iv)
Ans. b
40. Find the missing number in the following series:
a. 96
b. 91
c. 101
d. 121
Ans. c
41. If MONEY is to CARROM, MILITARY is to CHESS, COURT is to CRICKET then, WORLD WIDE WEB is to which of the following?
a. Kho Kho
b. Kabaddi
c. Boxing
d. Badminton
Ans. d
42. Which one of the following enzymes can hydrolyze both ester and amide bonds?
a. Methionine racemase
b. Thrombin
c. Chymotrypsin
d. Peroxidase
Ans. c
43. In the citric acid cycle operating under aerobic conditions, which one of the following is not directly involved?
a) NAD+
b) FAD
c) Molecular oxygen
d) Succinate
Ans. c
44. Identify the product(s) obtained when luciferin undergoes the following reaction:
a) Only I
b) I and II
c) Only IV
d) I, II and III
Ans. a
45. In the DNA methylation reaction mediated by S-adenosylmethionine (SAM) methyltransferase, the nucleophilic species involved is:
a. an alcohol
b. an amine
c. a thiol
d. a carboxylate
Ans. b
46. Correlation coefficient is a number between:
a. +1 and +2
b. 0 and +1
c. -1 and 0
d. -1 and +1
Ans. d
47. While making 100 ml of 2M NaCl solution, a student left the solution on a heating platform reducing the volume by 50 ml. This solution was diluted 1:100 for use. What is the final concentration of NaCl in this solution?
a. 20 mM
b. 80 mM
c. 40 mM
d. 400 mM
Ans. c
48. The pKa of acetic acid is 4.76. At what pH would the concentration of acetic acid and acetate ion be the same?
a. pH= 7
b. pH = 6.7
c. pH = 9.8
d. pH = 4.76
Ans. d
49. 14C has a half-life of 5760 years; 100 mg of a sample of 14C will completely disintegrate in:
a. 23,040 years
b. 1440 years
c. 11,520 years
d. infinite time
Ans. d
50. A young scientist was interested in creating a dipeptide using L-alanine and L-glycine. How many different dipeptides can be generated?
a. One
b. Two
c. Three
d. Four
Ans. d
Next Page
